Tmem192-3ha
WebApr 21, 2024 · TMEM192-3×HA is a significant improvement over earlier attempts at this strategy, where the lysosome-associated membrane protein 1 (LAMP1) fused to a cytosolic FLAG epitope tag (LAMP1-FLAG) failed to purify lysosomes efficiently [ 32 ]. WebSep 16, 2024 · A CAG-loxP-neomycin-Stop-loxP-FRT-TMEM192-3xHA-FRT-pA cassette incorporating full-length human TMEM192 cDNA coding sequences fused to a 3x …
Tmem192-3ha
Did you know?
WebTMEM192 (transmembrane protein 192) is a membrane protein that localizes to lysosomes. [ 1] It has a predominant expression in lung, liver, pancreas and kidney. It exists as a … WebTransmembrane protein 192 (TMEM192) has been previously identified in proteomic analyses of lysosomal membranes. TMEM192 does not exhibit any significant homology to known protein families and...
WebTMEM192 is a transmembrane protein (8) that we find retains its lysosomal localization upon overexpression better than other such proteins, like lysosomal-associated membrane protein 1 (LAMP1). WebFeb 11, 2011 · TMEM192 (transmembrane protein 192) is a novel constituent of late endosomal/lysosomal membranes with four potential transmembrane segments and an unknown function that was initially discovered by organellar proteomics. Subsequently, localization in late endosomes/lysosomes has been confirmed for overexpressed and …
WebTMEM192, transmembrane protein 192 Vertebrate Orthologs 3 Mutations, Alleles, and Phenotypes less Phenotype Summary 1 phenotype from 1 allele in 1 genetic background … WebJul 23, 2024 · It uses TMEM192-3HA, a lysosome-specific membrane protein, as the bait to pull down intact lysosomes. As expected, full-length GFP-RNF152 and other lysosome …
WebTMEM192 Promoter CMV Tag / Fusion Protein 3XHA (C terminal on insert) Cloning Information Cloning method Gibson Cloning 5′ sequencing primer ATTTAGGTGACACTATAG (Common Sequencing Primers) Terms and Licenses Academic/Nonprofit Terms UBMTA Industry Terms Not Available to Industry Trademarks: Zeocin® is an InvivoGen trademark.
WebMar 21, 2024 · GeneCards Summary for TMEM219 Gene. TMEM219 (Transmembrane Protein 219) is a Protein Coding gene. Diseases associated with TMEM219 include … norman b leventhalTMEM192 Promoter ubc Tag / Fusion Protein HA (C terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site AgeI (not destroyed) 3′ cloning site EcorI (not destroyed) 5′ sequencing primer CGAAGGAATAGAAGAAGAAGGTGGAGA (Common Sequencing Primers) Resource Information Articles Citing this Plasmid 8 References norman block obituaryWebMy Western Blot images show contamination of ER proteins (calreticulin and calnexin) and few of mitochondria protein (VDAC) though negative controls (cells not expressing TMEM 192-HA) does not show... how to remove steam shortcutsWebMar 21, 2024 · TMEM192 (Transmembrane Protein 192) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity . Additional gene information for TMEM192 Gene HGNC (26775) NCBI Entrez Gene (202431) Ensembl (ENSG00000170088) UniProtKB/Swiss-Prot (Q8IY95) Open Targets Platform … norman bobrow and coWebJul 4, 2024 · TMEM192 exhibits four transmembrane segments with cytosolic N- and C-termini and forms homodimers. Devoid of significant homologies, the molecular function … how to remove steam market listing holdWebJun 20, 2012 · The results suggest that TMEM192 is important for tumor cell growth and proliferation. TMEM192 deficiency can induce autophagy in tumor cells, and can further … how to remove steam skinsWebRecombinant Anti-TMEM192 antibody [EPR14330] (ab185545) Datasheet SDS Certificate of Compliance Submit a review Submit a question Key features and details Produced recombinantly (animal-free) for high batch-to-batch consistency and long term security of supply Rabbit monoclonal [EPR14330] to TMEM192 Suitable for: Flow Cyt (Intra), WB, ICC/IF norman blinds color code